Preview

GE Hw 2

Satisfactory Essays
Open Document
Open Document
248 Words
Grammar
Grammar
Plagiarism
Plagiarism
Writing
Writing
Score
Score
GE Hw 2
Mujtaba Zafar 10/15/14
Michael Hadjiargyrou Bio 440

Answers only:
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
385 bits(208)
2e-103
229/238(96%)
5/238(2%)
Plus/Plus
Query 1 AGTTATCATGGCCTCCCAAACCACTCACAAAGAAGAAAAAGAGTTTCCAGGAACTAGAAG 60 ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct 2774 AGTTATCATGGCCTCCCAAACCACTCACAAAGAAG-AAAAGAGTTTCCAGGAACTAGAAG 2832

Query 61 ATGATTTAGATACCATGGAATTAGAGGATATTGATACAACAGACATCAATCTGGATGAAG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2833 ATGATTTAGATACCATGGAATTAGAGGATATTGATACAACAGACATCAATCTGGATGAAG 2892

Query 121 ATATTCTTGATGACTAAAGAAAGCCCATTTACTCCAGTAAGAGATTATGATGGCACATAC 180 ||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||
Sbjct 2893 ATATTCTGGATGACTAAAGTTTG-CCATTTACTCCAGTAAGAGATTATGATGGCACATAC 2951

Query 181 AAATCAGTCACCACCCTGACCAGAAACTGTGGCAATCCTTGCTCTGGCAGCACGTAAA 238 ||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||
Sbjct 2952 AAATCAGTCACCACCCTGACCAG-AACTGTGGCAATCCTTGCTCTG-CA-CACGTAAA 3006

Function: This genes main function is to act as a receptor for the activated protein kinase C epsilon and can also be found playing a role in vesicle-mediated transport.

2A) We would use the genomic library because the promoting sequence wouldn’t be found in the cDNA library.

B) For this part I would use the DNA library because it will have the full length DNA sequence. The cDNA would be missing tRNA and rRNA because it is made from the mRNA.

C) I would use the cDNA for this part because we are looking for the expressed DNA so we don’t need all the introns, therefore cDNA would be more ideal.

D) Genomic library since we would be looking at the whole DNA sequence.

E) For this part I will consider using cDNA since bacteria doesn’t carry out post transcriptional modifications so it will have the whole

You May Also Find These Documents Helpful

  • Satisfactory Essays

    c) What would be the resulting mRNA, assuming RNA polymerase will use the DNA sequence, - CTCTTAGATGGA - ? (4 points)…

    • 276 Words
    • 3 Pages
    Satisfactory Essays
  • Satisfactory Essays

    b) Sequence B was the ending fragment since it ends with the stop codon, UGA.…

    • 366 Words
    • 2 Pages
    Satisfactory Essays
  • Good Essays

    E) cut the plasmid with enzyme X and then insert the gene into the plasmid.…

    • 4889 Words
    • 20 Pages
    Good Essays
  • Good Essays

    Dna Sci/230

    • 494 Words
    • 2 Pages

    3. Describe each stage of the flow of information starting with DNA and ending with a trait.…

    • 494 Words
    • 2 Pages
    Good Essays
  • Satisfactory Essays

    Forensic 1 Unit 7 Text

    • 260 Words
    • 1 Page

    4. Which of the DNA typing techniques do you think you would choose if you had to analyze a DNA sample? Why? I would choose the electronic gel technique.…

    • 260 Words
    • 1 Page
    Satisfactory Essays
  • Good Essays

    c. In _ lysogeny __, the phage genome integrates into bacterial genome creating a prophage.…

    • 814 Words
    • 4 Pages
    Good Essays
  • Satisfactory Essays

    Revision Questions

    • 510 Words
    • 3 Pages

    b. Select one of the criteria stated above and describe experimental evidence used to determine that DNA is the hereditary material.…

    • 510 Words
    • 3 Pages
    Satisfactory Essays
  • Satisfactory Essays

    Practice Qs

    • 559 Words
    • 3 Pages

    Practice questions for Genomics and Proteomics, Comparative Genomics, and Bioinformatics 1. Which of the following are pyrimidines? A. Adenine and Thymine B. Cytosine and Thymine C. Cysteine and Guanine D. Cytosine and Guanine 2. Which of the following is not static in an organism? A. Transcriptome B. Proteome C. Chromosome number…

    • 559 Words
    • 3 Pages
    Satisfactory Essays
  • Good Essays

    Week 5 Study Guide

    • 792 Words
    • 4 Pages

    D. What are the two stages required to go from DNA to trait formation and where does each stage occur in a cell?…

    • 792 Words
    • 4 Pages
    Good Essays
  • Good Essays

    Whatv Ve

    • 1157 Words
    • 5 Pages

    21. Describe the genetic material of the bacteria. be sure to tell where it is found.…

    • 1157 Words
    • 5 Pages
    Good Essays
  • Satisfactory Essays

    Reversing Entries

    • 388 Words
    • 2 Pages

    3. Describe each stage of the flow of information starting with DNA and ending with a trait.…

    • 388 Words
    • 2 Pages
    Satisfactory Essays
  • Good Essays

    HW1

    • 795 Words
    • 4 Pages

    Background information: Tumor cells are cells that are able to divide and generate new cells at uncontrolled rates. Therefore, in a short amount of time, a single mutated tumor cell can produce many other tumor cells. These cells can eventually take over the human body, resulting in death. But, for these tumor cells to survive, they need nutrition and oxygen just like normal cells. Tumor cells are interesting in that they can release a substance – a protein – that will cause blood vessels to grow towards the ball of tumor cells. This process by which blood vessels grow is called angiogenesis. Blood vessels are required because they are the route by which cells will receive nutrition and oxygen. Therefore, if there were a chemical that could interrupt the growth of the blood vessels towards the ball of tumor cells then it is conceivable that the growth of the tumor could be slowed or halted all together. A protein, called endostatin, has been isolated and scientists want to determine its effect on the growth of blood vessels. Tumor cells can be grown outside of the body in a culture dish, which provides a relatively easy method to test endostatin and how it affects tumor cells and, by having the tumor cells and blood vessels isolated in a culture dish, the environmental conditions can more readily be…

    • 795 Words
    • 4 Pages
    Good Essays
  • Good Essays

    Beginning Of Life On Earth

    • 1006 Words
    • 3 Pages

    c) What are the main functions of proteins and nucleic acids (DNA)? What is a significant difference between these molecules?…

    • 1006 Words
    • 3 Pages
    Good Essays
  • Satisfactory Essays

    Gram Staining

    • 3035 Words
    • 13 Pages

    E. list the steps in preparing a Gram stain and describe the appearance of a gram-positive and gram- negative cells after each step.\…

    • 3035 Words
    • 13 Pages
    Satisfactory Essays
  • Good Essays

    Types of Grammar Test

    • 947 Words
    • 4 Pages

    a. Three things are especially crucial to understanding the possible uses of the human genome.…

    • 947 Words
    • 4 Pages
    Good Essays